bio-workflows-crispr-editing-pipeline

star 30

End-to-end CRISPR experiment design from target selection to delivery-ready constructs. Covers guide RNA design, off-target assessment, and specialized editing strategies including knockouts, base editing, and HDR knockins. Use when designing complete CRISPR editing experiments for gene knockout, correction, or tagging.

mdbabumiamssm By mdbabumiamssm schedule Updated 2/4/2026

name: bio-workflows-crispr-editing-pipeline description: End-to-end CRISPR experiment design from target selection to delivery-ready constructs. Covers guide RNA design, off-target assessment, and specialized editing strategies including knockouts, base editing, and HDR knockins. Use when designing complete CRISPR editing experiments for gene knockout, correction, or tagging. tool_type: mixed primary_tool: crisprscan workflow: true depends_on: - genome-engineering/grna-design - genome-engineering/off-target-prediction - genome-engineering/base-editing-design - genome-engineering/prime-editing-design - genome-engineering/hdr-template-design qc_checkpoints: - after_grna_design: "Activity score >0.6, no poly-T runs, GC 40-70%" - after_offtarget: "Specificity score >0.7, no coding off-targets with <3 mismatches" - after_template: "Homology arms verified, PAM disrupted in donor" measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools: - read_file - run_shell_command

CRISPR Editing Pipeline

Complete workflow for CRISPR experiment design: from target gene to delivery-ready constructs with branching paths for different editing strategies.

Workflow Overview

Target Gene/Position
        |
        v
[1. Guide RNA Design] --> CRISPRscan / Rule Set 2 / DeepCRISPR
        |
        v
[2. Off-Target Assessment] --> Cas-OFFinder + CFD scoring
        |
        v
    Decision Point: What type of edit?
        |
    +---+-------------------+--------------------+
    |                       |                    |
    v                       v                    v
[3a. Knockout]        [3b. Base Editing]   [3c. Knockin]
 Standard Cas9         CBE/ABE design       HDR template
 Frameshift            C>T or A>G           with homology arms
        |                   |                    |
        v                   v                    v
    Final Constructs with Validation Primers

Prerequisites

pip install crisprscan biopython pandas numpy matplotlib

conda install -c bioconda primer3-py cas-offinder

# Python packages for scoring
pip install crisprtools  # if available

Primary Path: Gene Knockout

Step 1: Guide RNA Design

from Bio import SeqIO
from Bio.Seq import Seq
import pandas as pd
import re

def find_guides(sequence, pam='NGG'):
    '''Find all potential gRNA target sites with NGG PAM.'''
    guides = []
    seq_str = str(sequence).upper()

    # Forward strand: 20bp + NGG
    for match in re.finditer(r'(?=([ATCG]{20}[ATCG]GG))', seq_str):
        pos = match.start()
        target = match.group(1)[:20]
        pam_seq = match.group(1)[20:23]
        guides.append({
            'sequence': target,
            'pam': pam_seq,
            'position': pos,
            'strand': '+',
            'full_target': match.group(1)
        })

    # Reverse strand: CCN + 20bp
    for match in re.finditer(r'(?=(CC[ATCG][ATCG]{20}))', seq_str):
        pos = match.start()
        full = match.group(1)
        target = str(Seq(full[3:23]).reverse_complement())
        pam_seq = str(Seq(full[0:3]).reverse_complement())
        guides.append({
            'sequence': target,
            'pam': pam_seq,
            'position': pos,
            'strand': '-',
            'full_target': full
        })

    return pd.DataFrame(guides)


def score_guide(guide_seq):
    '''Score guide using Rule Set 2-like heuristics.'''
    score = 0.5  # Base score

    # GC content (optimal: 40-70%)
    gc = (guide_seq.count('G') + guide_seq.count('C')) / len(guide_seq)
    if 0.4 <= gc <= 0.7:
        score += 0.2
    elif gc < 0.3 or gc > 0.8:
        score -= 0.2

    # No poly-T (>4 T's is Pol III terminator)
    if 'TTTT' in guide_seq:
        score -= 0.3

    # G at position 20 (adjacent to PAM) preferred
    if guide_seq[-1] == 'G':
        score += 0.1

    # Avoid GG at positions 19-20
    if guide_seq[-2:] == 'GG':
        score -= 0.1

    # Seed region (positions 12-20) GC
    seed = guide_seq[11:20]
    seed_gc = (seed.count('G') + seed.count('C')) / len(seed)
    if 0.4 <= seed_gc <= 0.7:
        score += 0.1

    return min(1.0, max(0.0, score))


# Example: Design guides for BRCA1 exon
gene_seq = '''ATGGATTTATCTGCTCTTCGCGTTGAAGAAGTACAAAATGTCATTAATGCTATGCAGAAAATCTTAGAGT
GTCCCATCTGTCTGGAGTTGATCAAGGAACCTGTCTCCACAAAGTGTGACCACATATTTTGCAAATTTTG'''

guides = find_guides(gene_seq.replace('\n', ''))
guides['activity_score'] = guides['sequence'].apply(score_guide)

# Filter high-scoring guides
# Activity score >0.6 is standard threshold for reliable editing
good_guides = guides[guides['activity_score'] > 0.6].sort_values('activity_score', ascending=False)
print(f'Found {len(good_guides)} high-scoring guides')
print(good_guides[['sequence', 'position', 'strand', 'activity_score']].head(10))

Step 2: Off-Target Assessment

import subprocess
from pathlib import Path

def run_cas_offinder(guides_df, genome_fasta, output_dir, max_mismatches=4):
    '''Run Cas-OFFinder for off-target detection.'''
    output_dir = Path(output_dir)
    output_dir.mkdir(parents=True, exist_ok=True)

    # Write input file
    input_file = output_dir / 'cas_offinder_input.txt'
    with open(input_file, 'w') as f:
        f.write(f'{genome_fasta}\n')
        f.write('NNNNNNNNNNNNNNNNNNNNNGG\n')  # 20bp + NGG pattern
        for _, row in guides_df.iterrows():
            f.write(f"{row['sequence']}NNN {max_mismatches}\n")

    # Run Cas-OFFinder
    output_file = output_dir / 'offtargets.txt'
    subprocess.run([
        'cas-offinder', str(input_file), 'C', str(output_file)  # C for CPU
    ], check=True)

    # Parse results
    offtargets = pd.read_csv(output_file, sep='\t', header=None,
                              names=['pattern', 'chromosome', 'position', 'target',
                                    'strand', 'mismatches'])
    return offtargets


def calculate_specificity_score(guide_seq, offtargets_df):
    '''Calculate CFD-based specificity score.'''
    # Simplified: penalize based on mismatch count and position
    guide_offtargets = offtargets_df[offtargets_df['pattern'].str.contains(guide_seq[:10])]

    if len(guide_offtargets) == 0:
        return 1.0

    # Weight by mismatch count (more mismatches = lower penalty)
    penalty = 0
    for _, ot in guide_offtargets.iterrows():
        mm = ot['mismatches']
        if mm == 0:  # Perfect match elsewhere (bad!)
            penalty += 1.0
        elif mm == 1:
            penalty += 0.5
        elif mm == 2:
            penalty += 0.2
        elif mm == 3:
            penalty += 0.1
        else:
            penalty += 0.05

    # Specificity score: higher is better
    # Score >0.7 is generally acceptable
    return max(0, 1 - penalty / 10)


# Filter by off-target profile
good_guides['specificity_score'] = good_guides['sequence'].apply(
    lambda x: calculate_specificity_score(x, pd.DataFrame())  # placeholder
)

# Combined score
good_guides['combined_score'] = (good_guides['activity_score'] * 0.5 +
                                  good_guides['specificity_score'] * 0.5)
final_guides = good_guides.sort_values('combined_score', ascending=False).head(5)

Step 3a: Knockout Design (Frameshift)

def design_knockout(guide_row, target_sequence):
    '''Design knockout experiment with validation primers.'''
    guide_seq = guide_row['sequence']
    position = guide_row['position']

    # Cas9 cuts 3bp upstream of PAM
    cut_site = position + 17 if guide_row['strand'] == '+' else position + 6

    # Validation primers flanking cut site (~200bp amplicon)
    # 200bp amplicon is optimal for detecting indels by gel or Sanger
    left_start = max(0, cut_site - 100)
    right_end = min(len(target_sequence), cut_site + 100)

    return {
        'guide_sequence': guide_seq,
        'pam': guide_row['pam'],
        'cut_site': cut_site,
        'expected_outcome': 'Frameshift indel',
        'validation_amplicon_start': left_start,
        'validation_amplicon_end': right_end
    }

ko_design = design_knockout(final_guides.iloc[0], gene_seq.replace('\n', ''))
print('Knockout Design:')
for k, v in ko_design.items():
    print(f'  {k}: {v}')

Step 3b: Base Editing Design (CBE/ABE)

def design_base_edit(target_position, target_sequence, edit_type='CBE'):
    '''Design base editing experiment.
    CBE: C>T conversion (or G>A on opposite strand)
    ABE: A>G conversion (or T>C on opposite strand)

    Editing window: positions 4-8 in the protospacer (counting from PAM-distal)
    '''
    guides = find_guides(target_sequence)

    suitable_guides = []
    for _, guide in guides.iterrows():
        guide_start = guide['position']
        guide_end = guide_start + 20

        # Check if target position falls in editing window (positions 4-8)
        # Window position 4-8 is optimal for BE3/BE4 (CBE) and ABE7.10/ABE8
        if guide['strand'] == '+':
            window_start = guide_start + 3  # Position 4
            window_end = guide_start + 8    # Position 8
        else:
            window_start = guide_end - 8
            window_end = guide_end - 3

        if window_start <= target_position <= window_end:
            # Check if target base is appropriate
            target_base = target_sequence[target_position].upper()
            if edit_type == 'CBE' and target_base in ['C', 'G']:
                suitable_guides.append(guide)
            elif edit_type == 'ABE' and target_base in ['A', 'T']:
                suitable_guides.append(guide)

    return pd.DataFrame(suitable_guides)


# Example: Design CBE to introduce stop codon
# C>T at specific position can create TAG/TAA/TGA stop
target_pos = 45  # Example position with C
cbe_guides = design_base_edit(target_pos, gene_seq.replace('\n', ''), 'CBE')
print(f'Found {len(cbe_guides)} CBE-compatible guides')

Step 3c: Knockin Design (HDR Template)

def design_hdr_template(guide_row, target_sequence, insert_sequence,
                         homology_arm_length=800):
    '''Design HDR donor template with homology arms.

    Homology arm length: 800bp is standard for plasmid donors.
    For ssODN, use 30-60bp arms.
    '''
    cut_site = guide_row['position'] + 17 if guide_row['strand'] == '+' else guide_row['position'] + 6

    # Extract homology arms
    # Arms flank the cut site
    left_arm_start = max(0, cut_site - homology_arm_length)
    left_arm = target_sequence[left_arm_start:cut_site]

    right_arm_end = min(len(target_sequence), cut_site + homology_arm_length)
    right_arm = target_sequence[cut_site:right_arm_end]

    # Mutate PAM in donor to prevent re-cutting
    # Change NGG to NGA or NAG (silent if possible)
    guide_seq = guide_row['sequence']
    pam_position_in_arms = cut_site - left_arm_start + 3

    # Full donor: left_arm + insert + right_arm
    donor = left_arm + insert_sequence + right_arm

    return {
        'guide_sequence': guide_seq,
        'cut_site': cut_site,
        'left_arm': left_arm,
        'right_arm': right_arm,
        'insert': insert_sequence,
        'donor_template': donor,
        'donor_length': len(donor),
        'note': 'Remember to mutate PAM in donor to prevent re-cutting'
    }


# Example: Insert GFP tag
gfp_sequence = 'ATGGTGAGCAAGGGCGAGGAG...'  # Truncated for example
hdr_design = design_hdr_template(final_guides.iloc[0], gene_seq.replace('\n', ''), 'FLAG_TAG', 50)
print('HDR Design:')
print(f"  Left arm length: {len(hdr_design['left_arm'])}")
print(f"  Right arm length: {len(hdr_design['right_arm'])}")
print(f"  Total donor length: {hdr_design['donor_length']}")

Visualization

import matplotlib.pyplot as plt
import matplotlib.patches as mpatches
import numpy as np

def plot_guide_landscape(guides_df, gene_length, exon_coords=None):
    '''Visualize guide positions and scores along gene.'''
    fig, axes = plt.subplots(2, 1, figsize=(14, 6), gridspec_kw={'height_ratios': [1, 2]})

    # Top: Gene structure
    ax1 = axes[0]
    ax1.axhline(y=0.5, color='gray', linewidth=10, solid_capstyle='butt')

    if exon_coords:
        for start, end in exon_coords:
            ax1.axhline(y=0.5, xmin=start/gene_length, xmax=end/gene_length,
                       color='steelblue', linewidth=20, solid_capstyle='butt')

    ax1.set_xlim(0, gene_length)
    ax1.set_ylim(0, 1)
    ax1.set_ylabel('Gene')
    ax1.set_xticks([])
    ax1.set_yticks([])

    # Bottom: Guide scores
    ax2 = axes[1]
    colors = ['green' if s > 0.6 else 'orange' if s > 0.4 else 'red'
              for s in guides_df['activity_score']]

    ax2.scatter(guides_df['position'], guides_df['activity_score'],
                c=colors, s=50, alpha=0.7)
    ax2.axhline(y=0.6, color='green', linestyle='--', alpha=0.5, label='Threshold')
    ax2.set_xlim(0, gene_length)
    ax2.set_ylim(0, 1)
    ax2.set_xlabel('Position (bp)')
    ax2.set_ylabel('Activity Score')
    ax2.legend()

    plt.tight_layout()
    plt.savefig('guide_landscape.pdf')
    return fig


# Plot
plot_guide_landscape(guides, len(gene_seq.replace('\n', '')),
                     exon_coords=[(0, 50), (70, 130)])

Parameter Recommendations

Step Parameter Value Rationale
Guide design Activity score >0.6 Standard threshold for reliable editing
Guide design GC content 40-70% Optimal for binding and Cas9 activity
Off-target Max mismatches 4 Catches most relevant off-targets
Off-target Specificity score >0.7 Acceptable off-target profile
Base editing Window positions 4-8 Optimal for BE3/BE4, ABE7.10
HDR Homology arms 800bp Standard for plasmid donors
HDR (ssODN) Homology arms 30-60bp For single-strand oligo donors

Troubleshooting

Issue Likely Cause Solution
No high-scoring guides GC-poor region Expand search region, consider Cas12a
Many off-targets Repetitive sequence Use high-fidelity Cas9 (eSpCas9, HiFi)
Low HDR efficiency NHEJ dominant Add NHEJ inhibitors, use ssODN
Base editing outside window Guide position Redesign with target in positions 4-8
Bystander edits Multiple C/A in window Design guides with single target base

Output Files

File Description
guides_ranked.tsv All guides with activity and specificity scores
offtargets.txt Cas-OFFinder results
knockout_design.json KO guide and validation primers
base_edit_design.json CBE/ABE design with editing window
hdr_template.fasta Donor template sequence
guide_landscape.pdf Visualization of guide positions

Related Skills

  • genome-engineering/grna-design - Detailed scoring algorithms
  • genome-engineering/off-target-prediction - Cas-OFFinder and CFD
  • genome-engineering/base-editing-design - CBE/ABE specifics
  • genome-engineering/prime-editing-design - pegRNA design
  • genome-engineering/hdr-template-design - Donor optimization
  • primer-design/primer-basics - Validation primer design
Install via CLI
npx skills add https://github.com/mdbabumiamssm/LLMs-Universal-Life-Science-and-Clinical-Skills- --skill bio-workflows-crispr-editing-pipeline
Repository Details
star Stars 30
call_split Forks 7
navigation Branch main
article Path SKILL.md
More from Creator
mdbabumiamssm
mdbabumiamssm Explore all skills →