crispr-offtarget-predictor

name: 'crispr-offtarget-predictor' description: 'Predicts potential off-target sites for a given sgRNA sequence using mismatch analysis.' measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools: - read_file - run_shell_command

CRISPR Off-Target Predictor

This skill identifies potential off-target binding sites for a specific sgRNA sequence. It helps researchers assess the specificity of their CRISPR design.

When to Use This Skill

• Designing new CRISPR experiments.
• Validating sgRNA specificity before synthesis.
• Analyzing potential safety risks in gene editing protocols.

Core Capabilities

1. Mismatch Scoring: Calculates mismatch penalties for potential sites.
2. PAM Validation: Filters targets based on PAM (Protospacer Adjacent Motif) compatibility.
3. Risk Assessment: Categorizes off-targets as Low, Medium, or High risk.

Workflow

1. Input: sgRNA sequence (20nt) and PAM (e.g., NGG).
2. Analysis: Scans a reference library (mocked for this version) for similar sequences.
3. Output: List of potential off-targets with locations and risk scores.

Example Usage

User: "Check sgRNA 'GAGTCCGAGCAGAAGAAGAA' for off-targets."

Agent Action:

python3 Skills/Genomics/CRISPR_Prediction/impl.py --sequence GAGTCCGAGCAGAAGAAGAA --pam NGG